Upscaling Statistical Patterns from Reduced Storage in Social and Life Science Big Datasets
C terminus,  Chlamydomonas,  Exosomes,  glycoproteins,  Hepatitis C virus,  HIV,  lipoprotein,  mediate,  morphogenesis,  NATtrol,  nonmotile,  Panel,  PCR,  pH-dependent cell,  PLC,  polypeptides,  pseudotyped retroviral particles,  recombinant,  Recombinant Proteins,  retroviral,  Ria Kits

Upscaling Statistical Patterns from Reduced Storage in Social and Life Science Big Datasets

Current technological and computational advances have enabled the gathering of information at an unprecedented price. On the one hand, the big quantity of information abruptly accessible has opened up new alternatives for brand spanking new data-driven analysis however, however, it has introduced into mild new obstacles and challenges associated to storage and evaluation limits. Right here, we strengthen an upscaling strategy borrowed from theoretical ecology that permits us to deduce with small errors related patterns of a dataset in its entirety, though solely a restricted fraction of it has been analysed.


Particularly we present that, after decreasing the enter quantity of knowledge on the system beneath research, by making use of our framework it’s nonetheless doable to get better two statistical patterns of curiosity of the complete dataset. Examined in opposition to massive ecological, human exercise and genomics knowledge, our framework was profitable within the reconstruction of world statistics associated to each the variety of sorts and their abundances whereas ranging from restricted presence/absence info on small random samples of the datasets. These outcomes pave the best way for future purposes of our process in numerous life science contexts, from social actions to pure ecosystems. The Chinese language nationwide faculty college students’ life science competitors has been held for thrice, with good group, giant scale and excessive participation diploma. The competitors performs an vital position in selling life science training and analysis.

This paper stories the shape and standing of the competitors, statistically analyses the registration knowledge and competitors outcomes by area and yr, based mostly on the earlier three competitions. By combining new modifications and understanding within the discipline of life science, we additionally point out prospects on the way to higher promote the competitors. Knowledge sharing and reuse are essential to reinforce scientific progress and maximize return of investments in science. Though attitudes are more and more favorable, knowledge reuse stays tough on account of lack of infrastructures, requirements, and insurance policies. The FAIR (findable, accessible, interoperable, reusable) rules goal to offer suggestions to extend knowledge reuse. Due to the broad interpretation of the FAIR rules, maturity indicators are needed to find out the FAIRness of a dataset. On this work, we suggest a reproducible computational workflow to evaluate knowledge FAIRness within the life sciences.


Automation within the Life Science Analysis Laboratory

Protocols within the tutorial life science laboratory are closely reliant on the guide manipulation of instruments, reagents and devices by a number of analysis workers and college students. In distinction to industrial and scientific laboratory environments, the utilization of automation to enhance or exchange guide duties is restricted. Causes of this ‘automation hole’ are distinctive to tutorial analysis, with inflexible short-term funding constructions, excessive ranges of protocol variability and a benevolent tradition of funding in folks over gear.
Automation, nevertheless, can bestow a number of advantages by enhancements in reproducibility, researcher effectivity, scientific translation, and security. Much less instantly apparent are the accompanying limitations, together with obsolescence and an inhibitory impact on the liberty to innovate. Rising the vary of automation choices appropriate for analysis laboratories would require extra versatile, modular and cheaper designs.
Tutorial and industrial builders of automation will more and more have to design with an environmental consciousness and an understanding that enormous high-tech robotic options will not be acceptable for laboratories with constrained monetary and spatial sources. To completely exploit the potential of laboratory automation, future generations of scientists would require each engineering and biology expertise. Automation within the analysis laboratory is more likely to be an more and more vital part of future analysis applications and can proceed the development of mixing engineering and science experience collectively to reply novel analysis questions.
Upscaling Statistical Patterns from Reduced Storage in Social and Life Science Big Datasets
Upscaling Statistical Patterns from Reduced Storage in Social and Life Science Big Datasets

Assessing Excessive Performers within the Life Sciences: Traits of Exams Used on the Worldwide Biology Olympiad (IBO) and Their Implications for Life Science Schooling

For many years, research have revealed college students’ reducing curiosity in science. Extracurricular studying opportunities-the Science Olympiads being a publicly well-known example-are an vital means recognized to deal with this problem and assist college students additional differentiate their pursuits. Higher understanding the underlying constructs and traits of Science Olympiad exams can present a number of implications not only for Science Olympiads, but in addition science training extra broadly, for instance, with regard to how the competitions’ worldwide juries defines expectations for top efficiency within the life sciences.
This research analyzes exams set by the Worldwide Biology Olympiad (IBO) for instance for a top-tier worldwide competitors within the life sciences. The findings lengthen earlier works on check merchandise traits towards scholar competitions and high-performer training. We carried out a scientific evaluation of N = 703 closed-ended and laboratory check objects from six IBO evaluation years throughout the competitors’s historical past.

HIV-1 Tat Protein Peptide

B1433-10 10 mg
EUR 512
Description: HIV-1 Tat Protein Peptide


5-02000 4 x 1mg Ask for price


HY-P0281 1mg
EUR 215

Tat/ Rat Tat ELISA Kit

ELI-34214r 96 Tests
EUR 886

TAT Antibody

35946-100ul 100ul
EUR 252

TAT antibody

39162-100ul 100ul
EUR 252

TAT antibody

10-2250 200 ul
EUR 813
Description: Mouse monoclonal TAT antibody

TAT Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TAT. Recognizes TAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

TAT 14

B5721-1 1 mg
EUR 324

TAT Antibody

DF8469 200ul
EUR 304
Description: TAT Antibody detects endogenous levels of total TAT.

Tat antibody

70R-8790 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Tat antibody

TAT Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TAT. Recognizes TAT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

TAT Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TAT. Recognizes TAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TAT Antibody

ABD8469 100 ug
EUR 438


HY-P0117 10mM/1mL
EUR 889


HY-P0281A 5mg
EUR 712

pCEP4- tat

PVT11063 2 ug
EUR 266


T20-100-10kg 10 kg
EUR 1161


T20-100-2Kg 2 Kg
EUR 291


T20-100-500g 500 g
EUR 116

Horse TAT Complexes(TAT Complexes) ELISA Kit

QY-E120059 96T
EUR 478

Human immunodeficiency virus-Tat Protein (HIV-Tat) ELISA

201-12-1915 96 tests
EUR 440
  • This immunodeficiency virus-Tat Protein ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human immunodeficiency virus-Tat Protein(HIV-Tat)ELISA

GA-E1931HM-48T 48T
EUR 289

Human immunodeficiency virus-Tat Protein(HIV-Tat)ELISA

GA-E1931HM-96T 96T
EUR 466

Human immunodeficiency virus-Tat Protein(HIV-Tat)ELISA

QY-E02393 96T
EUR 361

HIV1 tat protein

30-017001F 100 ug
EUR 1029
Description: Purified recombinant HIV1 tat protein

HIV1 tat protein

30-AH85 50 ug
EUR 960
Description: Purified recombinant HIV1 tat protein

Sox2 TAT protein

30R-AS056 25 ug
EUR 273
Description: Purified recombinant Human Sox2 TAT protein

HIV1 tat antibody

10-H30K 100 ug
EUR 581
Description: Mouse monoclonal HIV1 tat antibody

HIV1 tat antibody

20-000601 500 ul
EUR 403
Description: Rabbit polyclonal HIV1 tat antibody

HIV1 tat antibody

20-000601F 500 ul
EUR 384
Description: Rabbit polyclonal HIV1 tat antibody

HIV1 tat antibody

20-000602 100 ug
EUR 133
Description: Rabbit polyclonal HIV1 tat antibody

HIV1 tat antibody

20-HS75 50 ul
EUR 256
Description: Sheep polyclonal HIV1 tat antibody

HIV1 tat antibody

10-007001 100 ug
EUR 403
Description: Mouse monoclonal HIV1 tat antibody

TAT 2-4

5-02001 4 x 1mg Ask for price

Nanog-TAT Protein

  • EUR 5311.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

TAT Conjugated Antibody

C35946 100ul
EUR 397

TAT cloning plasmid

CSB-CL023175HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1365
  • Sequence: atggacccatacatgattcagatgagcagcaaaggcaacctctcctcaattctggacgtgcatgtcaacgttggtgggagaagctctgtgccgggaaaaatgaaaggcagaaaggccaggtggtctgtgaggccctcagacatggccaagaaaactttcaaccccatccgagcca
  • Show more
Description: A cloning plasmid for the TAT gene.

TAT Rabbit pAb

A6764-100ul 100 ul
EUR 308

TAT Rabbit pAb

A6764-200ul 200 ul
EUR 459

TAT Rabbit pAb

A6764-20ul 20 ul
EUR 183

TAT Rabbit pAb

A6764-50ul 50 ul
EUR 223

TAT Polyclonal Antibody

ABP56345-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human TAT
  • Applications tips:
Description: A polyclonal antibody for detection of TAT from Human, Mouse, Rat. This TAT antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TAT

TAT Polyclonal Antibody

ABP56345-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human TAT
  • Applications tips:
Description: A polyclonal antibody for detection of TAT from Human, Mouse, Rat. This TAT antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TAT

TAT Polyclonal Antibody

ABP56345-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human TAT
  • Applications tips:
Description: A polyclonal antibody for detection of TAT from Human, Mouse, Rat. This TAT antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TAT

TAT 2-4

H-7648.0500 0.5mg
EUR 136
Description: Sum Formula: C132H240N66O29; CAS# [1159916-66-1] net

TAT 2-4

H-7648.1000 1.0mg
EUR 219
Description: Sum Formula: C132H240N66O29; CAS# [1159916-66-1] net

Tat-NR2B9c (TFA)

HY-P0117A 25mg
EUR 807

TAT (48-57)

HY-P1575 5mg
EUR 257

TAT 2-4

HY-P1579 1mg
EUR 153


HY-P7391 50ug
EUR 533

TAT Polyclonal Antibody

ES7344-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TAT from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

TAT Polyclonal Antibody

ES7344-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TAT from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

TAT stable cells

SC012 2 x 106 cell/ml x 1ml
EUR 1500
Description: Stable cell line expressing codon humanized TAT gene and RFP with Blasticidin resistance

Anti-TAT antibody

STJ28847 100 µl
EUR 277
Description: This nuclear gene encodes a mitochondrial protein tyrosine aminotransferase which is present in the liver and catalyzes the conversion of L-tyrosine into p-hydroxyphenylpyruvate. Mutations in this gene cause tyrosinemia (type II, Richner-Hanhart syndrome), a disorder accompanied by major skin and corneal lesions, with possible mental retardation. A regulator gene for tyrosine aminotransferase is X-linked.

Anti-TAT antibody

STJ95908 200 µl
EUR 197
Description: Rabbit polyclonal to TAT.

SOX2-TAT, human

RC712-46 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Enzymes

Canine C-Peptide ELISA Kit

DLR-C-Peptide-c-48T 48T
EUR 527
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine C-Peptide ELISA Kit

DLR-C-Peptide-c-96T 96T
EUR 688
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human C-Peptide ELISA Kit

DLR-C-Peptide-Hu-48T 48T
EUR 398
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human C-Peptide ELISA Kit

DLR-C-Peptide-Hu-96T 96T
EUR 511
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C-Peptide ELISA Kit

DLR-C-Peptide-Mu-48T 48T
EUR 450
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C-Peptide ELISA Kit

DLR-C-Peptide-Mu-96T 96T
EUR 582
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C-Peptide ELISA Kit

DLR-C-Peptide-Ra-48T 48T
EUR 467
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C-Peptide ELISA Kit

DLR-C-Peptide-Ra-96T 96T
EUR 605
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine C-Peptide ELISA Kit

RDR-C-Peptide-c-48Tests 48 Tests
EUR 557

Canine C-Peptide ELISA Kit

RDR-C-Peptide-c-96Tests 96 Tests
EUR 774

Human C-Peptide ELISA Kit

RDR-C-Peptide-Hu-48Tests 48 Tests
EUR 404

Human C-Peptide ELISA Kit

RDR-C-Peptide-Hu-96Tests 96 Tests
EUR 556

Mouse C-Peptide ELISA Kit

RDR-C-Peptide-Mu-48Tests 48 Tests
EUR 465

Mouse C-Peptide ELISA Kit

RDR-C-Peptide-Mu-96Tests 96 Tests
EUR 643

Rat C-Peptide ELISA Kit

RDR-C-Peptide-Ra-48Tests 48 Tests
EUR 486

Rat C-Peptide ELISA Kit

RDR-C-Peptide-Ra-96Tests 96 Tests
EUR 672

Canine C-Peptide ELISA Kit

RD-C-Peptide-c-48Tests 48 Tests
EUR 533

Canine C-Peptide ELISA Kit

RD-C-Peptide-c-96Tests 96 Tests
EUR 740

Human C-Peptide ELISA Kit

RD-C-Peptide-Hu-48Tests 48 Tests
EUR 387

Human C-Peptide ELISA Kit

RD-C-Peptide-Hu-96Tests 96 Tests
EUR 532

Mouse C-Peptide ELISA Kit

RD-C-Peptide-Mu-48Tests 48 Tests
EUR 446

Mouse C-Peptide ELISA Kit

RD-C-Peptide-Mu-96Tests 96 Tests
EUR 615

Rat C-Peptide ELISA Kit

RD-C-Peptide-Ra-48Tests 48 Tests
EUR 465

Rat C-Peptide ELISA Kit

RD-C-Peptide-Ra-96Tests 96 Tests
EUR 643

Recombinant Human Nanog-TAT

7-05665 5µg Ask for price

Recombinant Human Nanog-TAT

7-05666 20µg Ask for price

Recombinant Human Nanog-TAT

7-05667 1mg Ask for price

HIV1 tat antibody (HRP)

61-007002 1 mg
EUR 381
Description: Mouse monoclonal HIV1 tat antibody (HRP)

HIV1 tat antibody (FITC)

61-007003 50 ug
EUR 178
Description: Mouse monoclonal HIV1 tat antibody (FITC)

HIV1 tat antibody (biotin)

61-007005 50 ug
EUR 349
Description: Mouse monoclonal HIV1 tat antibody (biotin)

HIV1 tat protein (FITC)

65-017003F 50 ug
EUR 133
Description: Purified recombinant HIV1 tat protein (FITC)

HIV1 tat antibody (FITC)

60-00602-3F 50 ug
EUR 540
Description: Rabbit polyclonal anti-tat HIV1 antibody (FITC)

HIV1 tat antibody (biotin)

60-00602-5 50 ug
EUR 457
Description: Rabbit polyclonal anti-tat HIV1 antibody (Biotin)

Active Tyrosine Aminotransferase (TAT)

  • EUR 664.48
  • EUR 281.00
  • EUR 2216.80
  • EUR 805.60
  • EUR 1511.20
  • EUR 508.00
  • EUR 5392.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8QZR1
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.7kDa
  • Isoelectric Point: 5
Description: Recombinant Mouse Tyrosine Aminotransferase expressed in: Available from E.coli, Yeast, Baculovirus and Mammalian cells

Nanog-TAT, human recombinant

EUR 240

Nanog-TAT, human recombinant

EUR 860
A categorical framework was developed to research objects based on 4 areas: formal traits, content material and practices, cognitive features, and the usage of representations. Our findings spotlight evaluation traits used to problem high-performing college students. We derive implications for normal life sciences training, in addition to for additional growing the assessments of Science Olympiads.

Leave a Reply

Your email address will not be published. Required fields are marked *