The Circular Life of Human CD38: From Basic Science to Clinics and Back
C terminus,  Chlamydomonas,  Exosomes,  glycoproteins,  Hepatitis C virus,  HIV,  lipoprotein,  mediate,  Medium & Serums,  morphogenesis,  NATtrol,  nonmotile,  Panel,  PCR,  pH-dependent cell,  PLC,  polypeptides,  pseudotyped retroviral particles,  recombinant,  Recombinant Proteins,  retroviral,  Ria Kits

The Circular Life of Human CD38: From Basic Science to Clinics and Back

Monoclonal antibodies (mAbs) had been initially thought-about as a potential “magic bullet” for in vivo elimination of tumor cells. mAbs represented step one: nevertheless, as they had been murine in nature (the earliest expertise on the sphere), they had been thought-about unfit for human purposes. This prompted the event of methods for cloning the variable areas of typical murine antibodies, genetically mounted on human IgG. The final step on this years-long course of was the design for the preparation of totally human reagents. The selection of the goal molecule was additionally problematic, since cancer-specific targets are fairly restricted in quantity. To beat this impediment within the planning phases of antibody-mediated remedy, consideration was centered on a set of regular molecules, whose quantitative distribution might stability a tissue-dependent generalized expression. The outcomes and medical success obtained with anti-CD20 mAbs revived curiosity in the sort of technique. Utilizing a number of myeloma (MM) as a tumor mannequin was difficult initially as a result of the plasma cells and their neoplastic counterpart eluded the efforts of the Workshop on Differentiation Antigens to discover a goal molecule completely expressed by these cells.

For that reason, consideration was turned to floor molecules which fulfill the requisites of being moderately good targets, even when not particularly restricted to tumor cells. In 2009, we proposed CD38 as a MM goal in advantage of its expression: it’s absent on early hematological progenitors, has variable however generalized restricted expression by regular cells, however is extraordinarily excessive in plasma cells and in myeloma. Additional, regulation of its expression gave the impression to be depending on quite a lot of components, together with publicity to all-trans retinoic acid (ATRA), a potent and extremely particular inducer of CD38 expression in human promyelocytic leukemia cells that are actually accepted for in vivo use. This evaluate discusses the historical past of human CD38, from its preliminary characterization to its concentrating on in antibody-mediated remedy of human myeloma.

Systematic critiques had been carried out for the next subjects: dispatch analysis of cardiac arrest, use of a agency floor for CPR, sequence for beginning CPR (compressions-airway-breaths versus airway-breaths-compressions), CPR earlier than calling for assist, period of CPR cycles, hand place throughout compressions, rhythm examine timing, suggestions for CPR high quality, different methods, public entry automated exterior defibrillator applications, evaluation of rhythm throughout chest compressions, CPR earlier than defibrillation, removing of foreign-body airway obstruction, resuscitation look after suspected opioid-associated emergencies, drowning, and hurt from CPR to victims not in cardiac arrest. The subjects that resulted in probably the most intensive process drive discussions included CPR throughout transport, CPR earlier than calling for assist, resuscitation look after suspected opioid-associated emergencies, suggestions for CPR high quality, and evaluation of rhythm throughout chest compressions. After dialogue of the scoping critiques and the proof replace, the duty drive prioritized a number of subjects for brand new systematic critiques.


Neonatal Life Help: 2020 Worldwide Consensus on Cardiopulmonary Resuscitation and Emergency Cardiovascular Care Science With Therapy Suggestions

This <i>2020 Worldwide Consensus on Cardiopulmonary Resuscitation and Emergency Cardiovascular Care Science With Therapy Suggestions</i> (CoSTR) for neonatal life help consists of proof from 7 systematic critiques, three scoping critiques, and 12 proof updates. The Neonatal Life Help Activity Power typically decided by consensus the kind of proof analysis to carry out; the subjects for the proof updates adopted session with Worldwide Liaison Committee on Resuscitation member resuscitation councils. The 2020 CoSTRs for neonatal life help are revealed both as new statements or, if acceptable, reiterations of current statements when the duty drive discovered they remained legitimate.
This doc now kinds the premise for ongoing proof analysis and reevaluation, which will probably be triggered as additional proof is revealed. Over 140 million infants are born yearly worldwide . If as much as 5% obtain positive-pressure air flow, this proof analysis is related to greater than 7 million new child infants yearly. Nevertheless, by way of early care of the new child toddler, among the subjects addressed are related to each single child born.
 The Circular Life of Human CD38: From Basic Science to Clinics and Back
The Circular Life of Human CD38: From Basic Science to Clinics and Back

Pediatric Life Help: 2020 Worldwide Consensus on Cardiopulmonary Resuscitation and Emergency Cardiovascular Care Science With Therapy Suggestions

This <i>2020 Worldwide Consensus on Cardiopulmonary Resuscitation and Emergency Cardiovascular Care Science With Therapy Suggestions</i> (CoSTR) for pediatric life help is predicated on probably the most intensive proof analysis ever carried out by the Pediatric Life Help Activity Power. Three forms of proof analysis had been used on this evaluate: systematic critiques, scoping critiques, and proof updates. Per settlement with the proof analysis suggestions of the Worldwide Liaison Committee on Resuscitation, solely systematic critiques might end in a brand new or revised remedy advice.
Systematic critiques carried out for this 2020 CoSTR for pediatric life help included the subjects of sequencing of airway-breaths-compressions versus compressions-airway-breaths within the supply of pediatric primary life help, the preliminary timing and dose intervals for epinephrine administration throughout resuscitation, and the targets for oxygen and carbon dioxide ranges in pediatric sufferers after return of spontaneous circulation.
IRF4 Blocking Peptide
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
IRF4 Blocking Peptide
DF6198-BP 1mg
EUR 195
Rat Interferon Regulatory Factor 4 (IRF4) ELISA Kit
DLR-IRF4-Ra-48T 48T
EUR 475
  • Should the Rat Interferon Regulatory Factor 4 (IRF4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Interferon Regulatory Factor 4 (IRF4) in samples from tissue homogenates, cell lysates or other biological fluids.
Rat Interferon Regulatory Factor 4 (IRF4) ELISA Kit
DLR-IRF4-Ra-96T 96T
EUR 616
  • Should the Rat Interferon Regulatory Factor 4 (IRF4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Interferon Regulatory Factor 4 (IRF4) in samples from tissue homogenates, cell lysates or other biological fluids.
Rat Interferon Regulatory Factor 4 (IRF4) ELISA Kit
RD-IRF4-Ra-48Tests 48 Tests
EUR 473
Rat Interferon Regulatory Factor 4 (IRF4) ELISA Kit
RD-IRF4-Ra-96Tests 96 Tests
EUR 655
Rat Interferon Regulatory Factor 4 (IRF4) ELISA Kit
RDR-IRF4-Ra-48Tests 48 Tests
EUR 495
Rat Interferon Regulatory Factor 4 (IRF4) ELISA Kit
RDR-IRF4-Ra-96Tests 96 Tests
EUR 685
phospho-IRF4(Tyr122/125) Blocking Peptide
AF4476-BP 1mg
EUR 195
IRF4 Antibody
AF4776 200ul
EUR 376
Description: IRF4 Antibody detects endogenous levels of IRF4.
IRF4 Antibody
AF0692 200ul
EUR 304
Description: IRF4 Antibody detects endogenous levels of IRF4.
IRF4 Antibody
ABF0692 100 ug
EUR 438
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
IRF4 antibody
70R-51567 100 ul
EUR 244
Description: Purified Polyclonal IRF4 antibody
IRF4 antibody
70R-31899 100 ug
EUR 327
Description: Rabbit polyclonal IRF4 antibody
IRF4 Antibody
ABD6198 100 ug
EUR 438
IRF4 Antibody
37663-100ul 100ul
EUR 252
IRF4 antibody
38169-100ul 100ul
EUR 252
IRF4 Antibody
33893-100ul 100ul
EUR 252
IRF4 Antibody
33893-50ul 50ul
EUR 187
IRF4 Antibody
43509-100ul 100ul
EUR 252
IRF4 Antibody
25305-100ul 100ul
EUR 390
IRF4 antibody
70R-18008 50 ul
EUR 435
Description: Rabbit polyclonal IRF4 antibody
IRF4 Antibody
DF6198 200ul
EUR 304
Description: IRF4 Antibody detects endogenous levels of total IRF4.
IRF4 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against IRF4. Recognizes IRF4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000
IRF4 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against IRF4. Recognizes IRF4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
IRF4 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against IRF4. Recognizes IRF4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
IRF4 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IRF4. Recognizes IRF4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000
IRF4 Antibody
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against IRF4. Recognizes IRF4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
IRF4 Antibody
CSB-PA250376-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against IRF4. Recognizes IRF4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
IRF4 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IRF4. Recognizes IRF4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000
IRF4 Conjugated Antibody
C37663 100ul
EUR 397
IRF4 Conjugated Antibody
C38169 100ul
EUR 397
Polyclonal IRF4 Antibody
APR06706G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IRF4 . This antibody is tested and proven to work in the following applications:
IRF4 cloning plasmid
CSB-CL011819HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1356
  • Sequence: atgaacctggagggcggcggccgaggcggagagttcggcatgagcgcggtgagctgcggcaacgggaagctccgccagtggctgatcgaccagatcgacagcggcaagtaccccgggctggtgtgggagaacgaggagaagagcatcttccgcatcccctggaagcacgcgggca
  • Show more
Description: A cloning plasmid for the IRF4 gene.
anti- IRF4 antibody
FNab04390 100µg
EUR 548.75
  • Immunogen: interferon regulatory factor 4
  • Uniprot ID: Q15306
  • Gene ID: 3662
  • Research Area: Epigenetics, Cancer, Metabolism
Description: Antibody raised against IRF4
IRF4 Rabbit pAb
A0524-100ul 100 ul
EUR 308
IRF4 Rabbit pAb
A0524-200ul 200 ul
EUR 459
IRF4 Rabbit pAb
A0524-20ul 20 ul
EUR 183
IRF4 Rabbit pAb
A0524-50ul 50 ul
EUR 223
IRF4 Rabbit pAb
A1052-100ul 100 ul
EUR 308
IRF4 Rabbit pAb
A1052-200ul 200 ul
EUR 459
IRF4 Rabbit pAb
A1052-20ul 20 ul
EUR 183
IRF4 Rabbit pAb
A1052-50ul 50 ul
EUR 223
Anti-IRF4 antibody
PAab04390 100 ug
EUR 386
anti-IRF4 (2F2)
LF-MA10153 100 ug
EUR 363
Description: Mouse monoclonal to IRF4
Anti-IRF4 antibody
STJ72734 100 µg
EUR 359
Anti-IRF4 antibody
STJ24229 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the IRF (interferon regulatory factor) family of transcription factors, characterized by an unique tryptophan pentad repeat DNA-binding domain. The IRFs are important in the regulation of interferons in response to infection by virus, and in the regulation of interferon-inducible genes. This family member is lymphocyte specific and negatively regulates Toll-like-receptor (TLR) signaling that is central to the activation of innate and adaptive immune systems. A chromosomal translocation involving this gene and the IgH locus, t(6;14)(p25;q32), may be a cause of multiple myeloma. Alternatively spliced transcript variants have been found for this gene.
EF010383 96 Tests
EUR 689
Mouse IRF4 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human IRF4 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Anti-MUM1/IRF4 Antibody
PB9222 100ug/vial
EUR 334
IRF4 Recombinant Protein (Human)
RP016315 100 ug Ask for price
PVT19082 2 ug
EUR 258
IRF4 Recombinant Protein (Rat)
RP206234 100 ug Ask for price
IRF4 Recombinant Protein (Mouse)
RP144200 100 ug Ask for price
Canine C-Peptide ELISA Kit
DLR-C-Peptide-c-48T 48T
EUR 527
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Canine C-Peptide ELISA Kit
DLR-C-Peptide-c-96T 96T
EUR 688
  • Should the Canine C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human C-Peptide ELISA Kit
DLR-C-Peptide-Hu-48T 48T
EUR 398
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human C-Peptide ELISA Kit
DLR-C-Peptide-Hu-96T 96T
EUR 511
  • Should the Human C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse C-Peptide ELISA Kit
DLR-C-Peptide-Mu-48T 48T
EUR 450
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse C-Peptide ELISA Kit
DLR-C-Peptide-Mu-96T 96T
EUR 582
  • Should the Mouse C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat C-Peptide ELISA Kit
DLR-C-Peptide-Ra-48T 48T
EUR 467
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat C-Peptide ELISA Kit
DLR-C-Peptide-Ra-96T 96T
EUR 605
  • Should the Rat C-Peptide ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat C-Peptide in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Canine C-Peptide ELISA Kit
RD-C-Peptide-c-48Tests 48 Tests
EUR 533
Canine C-Peptide ELISA Kit
RD-C-Peptide-c-96Tests 96 Tests
EUR 740
Human C-Peptide ELISA Kit
RD-C-Peptide-Hu-48Tests 48 Tests
EUR 387
Human C-Peptide ELISA Kit
RD-C-Peptide-Hu-96Tests 96 Tests
EUR 532
Mouse C-Peptide ELISA Kit
RD-C-Peptide-Mu-48Tests 48 Tests
EUR 446
Mouse C-Peptide ELISA Kit
RD-C-Peptide-Mu-96Tests 96 Tests
EUR 615
Rat C-Peptide ELISA Kit
RD-C-Peptide-Ra-48Tests 48 Tests
EUR 465
Rat C-Peptide ELISA Kit
RD-C-Peptide-Ra-96Tests 96 Tests
EUR 643
Canine C-Peptide ELISA Kit
RDR-C-Peptide-c-48Tests 48 Tests
EUR 557
Canine C-Peptide ELISA Kit
RDR-C-Peptide-c-96Tests 96 Tests
EUR 774
Human C-Peptide ELISA Kit
RDR-C-Peptide-Hu-48Tests 48 Tests
EUR 404
Human C-Peptide ELISA Kit
RDR-C-Peptide-Hu-96Tests 96 Tests
EUR 556
Mouse C-Peptide ELISA Kit
RDR-C-Peptide-Mu-48Tests 48 Tests
EUR 465
Mouse C-Peptide ELISA Kit
RDR-C-Peptide-Mu-96Tests 96 Tests
EUR 643
Rat C-Peptide ELISA Kit
RDR-C-Peptide-Ra-48Tests 48 Tests
EUR 486
Rat C-Peptide ELISA Kit
RDR-C-Peptide-Ra-96Tests 96 Tests
EUR 672
Polyclonal IRF4 Antibody (C-Terminus)
APR02881G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IRF4 (C-Terminus). This antibody is tested and proven to work in the following applications:
phospho-IRF4(Tyr122/125) Antibody
AF4476 200ul
EUR 376
Description: phospho-IRF4(Y122/125) antibod detects endogenous levels of phospho-IRF4 only when phosphorylated at Y122/125.
Polyclonal IRF4 Antibody (C-Term)
APG00796G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human IRF4 (C-Term). This antibody is tested and proven to work in the following applications:
IRF4 Colorimetric Cell-Based ELISA
EKC1819 100ul
EUR 572
IRF4(Phospho-Tyr122/125) antibody
12846-100ul 100ul
EUR 252
IRF4(Phospho-Tyr122/125) antibody
12846-50ul 50ul
EUR 187
Recombinant Human IRF4 / MUM-1
7-05413 2µg Ask for price
Recombinant Human IRF4 / MUM-1
7-05414 5µg Ask for price
Recombinant Human IRF4 / MUM-1
7-05415 10µg Ask for price
IRF4 ORF Vector (Human) (pORF)
ORF005439 1.0 ug DNA
EUR 95
Irf4 ORF Vector (Rat) (pORF)
ORF068746 1.0 ug DNA
EUR 506
Irf4 ORF Vector (Mouse) (pORF)
ORF048068 1.0 ug DNA
EUR 506
pECMV-Irf4-m-FLAG Plasmid
PVT14835 2 ug
EUR 325
Anti-IRF4 (aa393-407) antibody
STJ73607 100 µg
EUR 359
IRF4 ELISA Kit (Rat) (OKCD04470)
OKCD04470 96 Wells
EUR 857
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.133 ng/mL
IRF4 ELISA Kit (Mouse) (OKCA00901)
OKCA00901 96 Wells
EUR 833
Description: Description of target: Transcriptional activator. Binds to the interferon-stimulated response element (ISRE) of the MHC class I promoter. Binds the immunoglobulin lambda light chain enhancer, together with PU.1. Probably plays a role in ISRE-targeted signal transduction mechanisms specific to lymphoid cells. Involved in CD8+ dendritic cell differentiation by forming a complex with the BATF-JUNB heterodimer in immune cells, leading to recognition of AICE sequence (5'-TGAnTCA/GAAA-3'), an immune-specific regulatory element, followed by cooperative binding of BATF and IRF4 and activation of genes.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL
Interferon Regulatory Factor 4 (IRF4) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Interferon Regulatory Factor 4 (IRF4) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Interferon Regulatory Factor 4 (IRF4) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Interferon Regulatory Factor 4 (IRF4) Antibody
abx145613-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Interferon Regulatory Factor 4 (IRF4) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Interferon Regulatory Factor 4 (IRF4) Antibody
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Interferon Regulatory Factor 4 (IRF4) Antibody
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
Interferon Regulatory Factor 4 (IRF4) Antibody
  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.
Interferon Regulatory Factor 4 (IRF4) Antibody
  • EUR 1247.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
Interferon Regulatory Factor 4 (IRF4) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Interferon Regulatory Factor 4 (IRF4) Antibody
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Interferon Regulatory Factor 4 (IRF4) Antibody
abx331791-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
Interferon Regulatory Factor 4 (IRF4) Antibody
abx432873-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Interferon Regulatory Factor 4 (IRF4) Antibody
abx234390-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Probably the most controversial subjects included the preliminary timing and dose intervals of epinephrine administration (new remedy suggestions had been made) and the administration of fluid for infants and kids with septic shock (this latter matter was evaluated by proof replace). All proof critiques recognized the paucity of pediatric information and the necessity for extra analysis involving resuscitation of infants and kids.

Leave a Reply

Your email address will not be published. Required fields are marked *